Product Information
Phase Detail
Clarity QSP
Clarity QSP 96-well plate and buffer system allows for purification of trityl on synthetic RNA and DNA
Clarity QSP
High-Throughput Purification

Purify trityl on synthetic DNA or RNA samples in 20 minutes using Clarity QSP 96-well plate and buffer system. Final elution delivers >90 % typical purities/recoveries for in vivo applications and downstream analysis by LC-MS or CE.

  • Formats offer easy high-throughput processing for parallel purifications
  • Simple three step process delivers highly purified DNA/RNA in minutes
  • For oligos 10-100 mer
  • Economical and disposable format

U.S. Patent No. 7,119,145

Brand
Clarity (SPE)
Recommended Use
Purification of trityl-on synthetic DNA or RNA samples resulting in high recoveries
General Extraction

Formats
Oligo Chemistry 96-Well Plates and 3 mL Cartridges
Synthesis Scale Load DNA & RNA
Oligo Length
  • 50 mg/well 96-well plates and 60 mg/3 mL tubes=up to 200 nmol
  • 150 mg/ 3 ml tubes= up to 1 µmol
  • 5 g/60 mL tubes= up to 25 µmol
Typical Purity1 ≤ 100 nt
Typical Recovery Yield2 ≥ 90 %
Typical Recovery Yield2 ≥ 80 %
Purification Time ~ 8 minutes/ cartridge
~ 45 minutes/ well plate (96 samples)
Equipment Required Positive pressure manifold, vacuum manifold, or automated liquid handling system

1 Purity value based on ion-exchange chromatography and capillary electrophoresis
2 OD260 used for quantitation

It’s Quick, Simple, and Pure (QSP)

Pre-treatment

Trityl-on oligo sample preparation. Mix equal volume of loading buffer with cleavage/deprotection solution

Clarity QSP 96-well plate with DNA Buffer

Crude 30 mer DNA- 200 nmole Sequence: GTGGATCTGCGCACTTCAGGCTCCTGGGCG

Sample Preparation:

  • 250 µL of oligo solution in concentrated NH2OH  (post deprotection) was aliquoted
  • An equal volume of DNA buffer (250 µL) was added and vortexed
Condition:
1 mL Methanol (2 x 0.5 mL)
Equilibrate:
1 mL Water (2 x 0.5 mL)
Load:
Oligo Sample (500 µL)
Detritylate:
1 mL 1 % DCA
Rinse:
1 mL Water (2 x 0.5 mL)
Dry Sorbent:
at 10” Hg Vacuum (~1 min)
Elute:

1 mL 15 mM Na2CO3/ 20 % Acetonitrile

Crude Trityl-on Load Fraction Detritylated Final Elution Recovery Purity (Peak area)
28.3 5.3 20.8 90.3 % 92 %