Product Information
Phase Detail
Clarity Oligo-RP
Clarity Oligo-RP HPLC columns offer purification for oligonuceleotides
Clarity Oligo-RP
Reversed Phase LC for Purification and Characterization

Clarity Oligo-RP has been specifically designed for the reversed phase purification of oligonucleotides with balanced hydrophobicity and polar selectivity. The media is based on composite particle TWIN™ technology. This technology gives improved selectivity and efficiency for oligonucleotides when compared to other hybrid, polymer, and silica particles found in the marketplace. It is available in 3, 5, and 10 µm particle sized beads and in a variety of dimensions.

  • Easily separate N-1 failure sequences from target oligo with > 90% purities
  • Trityl-off purification of DNA, RNA, Thioates, and modified/labeled Oligos
  • Preparative dimensions and particle sizes for loads > 5μmol
  • Purify oligos up to 60 mer in length
  • Excellent column for reversed phase HPLC quality control (QC) testing

Analytical LC

Clarity Oligo-RP™

Clarity Oligo-RP columns have been specifically designed for the reversed phase purification of oligonucleotides with balanced hydrophobicity and polar selectivity. Available in 3, 5, and 10 µm particles, Clarity Oligo-RP allows for high capacity analysis and purification of oligos.

A Highly Selective Analysis

Application 16021: Quadratic regression 1-1000 ng/mL

Column:
Clarity 3 µm Oligo-RP C18
Dimension:
50 x 4.6 mm
Part No.:
00B-4441-E0
Mobile Phase:
A: 50 mM TEAA pH 7.5
B: Methanol
Gradient:
10 % to 45 % B in 30 minutes
Flow Rate:
1 mL/min
Detection:
UV @ 260 nm
Sample:
1. 40nt DNA with sequence
CTTCTGAACAGTT- GATCTATG- CACTTCAGACTTATGATCA (2.5 μg)
2. 39nt DNA with sequence TTCTGAACAGTTGATCTAT- GCACTTCAGACTTATGATCA (2.5 μg)
 

Clarity Oligo-RP successfully separates a 40mer from a 39mer DNA oligonucleotide due to its excellent efficiency and resolving power.

Purification

Purification Clarity™

Clarity Oligo-RP columns allow for high loadability and deliver high recovery and purity, from HPLC to Preparative Purification.


Easily Scale from HPLC to Preparative Purification.

DNA Purification

Column:
Clarity 3 µm Oligo-RP C18
Dimension:
(A) 50 x 10.0 mm
(B) 50 x 4.6 mm
Mobile Phase:
A: 50 mM TEAA pH 7.5/ 5 % Acetonitrile
B: Methanol
Gradient:
10 % to 60 % B in 20 minutes
Flow Rate:
(A)  4.7 mL/ min
(B)  1.0 mL/ min
Detection:
UV @ 280 nm
Sample:
20nt DNA